Example sentences of "[pron] [adj] [coord] [art] [noun] [noun sg] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | when I lost my six and a half stone |
| 2 | My two and a quarter petrol 1981 SWB would have needed an expensive conversion to run on unleaded petrol so I am using Carbonflo instead . |
| 3 | Can you tell me the year of manufacture of my two and a quarter petrol engine number 90110300A . |
| 4 | To achieve more power for towing in my two and a quarter petrol County , I want to fit a Rover 3.5 SD1 engine . |
| 5 | This section of the towpath was about six feet wide , with the riverside cottages to their left and an iron railing to the right . |
| 6 | Recombinants ‘ oligo I ’ and ‘ oligo III ’ were produced by cloning the sequence CTGGGGAGGCGACCCCTCCCCCCTTGTCCCGACT ( nts -527 to -494 ) and its complementary or the oligonucleotide TCGCCCAGCTCAGGGCCGCGTGTGTTAGTT ( nts -479 to -450 ) and its complementary at the HindIII site of plasmid pBLcat2 ( 16 ) . |
| 7 | Sonny had been Thailand 's foremost classical dancing teacher , with a school of her own and a television programme . |
| 8 | Carrie had Nick 's case as well as her own and a carrier bag with a broken string handle . |
| 9 | A multi-millionairess with a fortune estimated at more than £10 million , a property tycoon in Australia where she was spending a fortune renovating her latest acquisition , a mammoth Victorian town house in the Melbourne suburbs , a singer poised to come of age with a backing band of her own and a world tour — the hologramic face of high technology in Japan , how could she ever again have been expected to have slipped into oily dungarees to tinker with the engine of a Land Rover ? |
| 10 | The goats are attacked by a troll as they cross a river , and through their cunning and the brute strength of the biggest of them , overcome their assailant and complete the crossing to the lush pasture on the other side . |
| 11 | SDLP deputy leader Seamus Mallon said he thought he had seen it all but the hospital bombing had broken ‘ every precept of human compassion and morality ’ . |
| 12 | After understanding this , you need to learn as much as possible about what makes him " tick " ; how does he handle himself in business ; what are his job ambitions ; is he married and a family man or still single ; what are his interests in sports , gardening , sailing and other leisure pursuits ; can you define his life style . |
| 13 | The week after their LP , Pleasure Dome , entered the charts at number one it was displaced by Wham 's Make It Big and the Frankie moment was over . |
| 14 | His Cabinet was not his own but an inheritance front Law . |
| 15 | In one case , which has still to come to trial , it is not clear which hat the salesman was wearing when he made his deals : his own or the life company 's . |
| 16 | Dust hung in the air now , making it yellow and the sun orange . |
| 17 | Charles II was proclaimed king in May 1660 and , because parliament declared he had been de jure king since his father 's death , his first year of actual kingship was designated his twelfth and a starting date of 29 May was adopted . |
| 18 | But opponents of fox hunting say the video says nothing new and the publicity launch suggests the Hunt Supporters , themselves , are on the run . |
| 19 | Over time we absorb them as our own and the culture shock retreats as we internalize the values and beliefs ( I discuss this in some detail in Chapter 6 ) . |