Example sentences of "[pron] [adj] [conj] [art] [noun sg] [noun sg] " in BNC.
Next pageNo | Sentence |
---|---|
1 | when I lost my six and a half stone |
2 | My two and a quarter petrol 1981 SWB would have needed an expensive conversion to run on unleaded petrol so I am using Carbonflo instead . |
3 | Can you tell me the year of manufacture of my two and a quarter petrol engine number 90110300A . |
4 | To achieve more power for towing in my two and a quarter petrol County , I want to fit a Rover 3.5 SD1 engine . |
5 | There 's nothing nicer than an evening hack after a day in the office , and even if you prefer riding earlier , the extra hour of daylight somehow seems to lift the spirits . |
6 | Yet although this turned out to be the case and Edna 's and Bert 's spells at Four Winds gave Harriet increasing support , she was still unable to rouse Liza out of her permanent lethargy or to get her further than the garden gate . |
7 | This section of the towpath was about six feet wide , with the riverside cottages to their left and an iron railing to the right . |
8 | Recombinants ‘ oligo I ’ and ‘ oligo III ’ were produced by cloning the sequence CTGGGGAGGCGACCCCTCCCCCCTTGTCCCGACT ( nts -527 to -494 ) and its complementary or the oligonucleotide TCGCCCAGCTCAGGGCCGCGTGTGTTAGTT ( nts -479 to -450 ) and its complementary at the HindIII site of plasmid pBLcat2 ( 16 ) . |
9 | Used on their own as a research method they have limitations but , within these , much can be achieved . |
10 | Sonny had been Thailand 's foremost classical dancing teacher , with a school of her own and a television programme . |
11 | Carrie had Nick 's case as well as her own and a carrier bag with a broken string handle . |
12 | A multi-millionairess with a fortune estimated at more than £10 million , a property tycoon in Australia where she was spending a fortune renovating her latest acquisition , a mammoth Victorian town house in the Melbourne suburbs , a singer poised to come of age with a backing band of her own and a world tour — the hologramic face of high technology in Japan , how could she ever again have been expected to have slipped into oily dungarees to tinker with the engine of a Land Rover ? |
13 | The goats are attacked by a troll as they cross a river , and through their cunning and the brute strength of the biggest of them , overcome their assailant and complete the crossing to the lush pasture on the other side . |
14 | Even more than in the 1930s , the TUC were imprisoned within constraints imposed on it by a capitalist wage-structure : the TUC argued strongly for adequate pensions ( denying , for example , that an old person needed less to eat ) ; but if this was to be implemented without encouraging further wage-cuts to elderly workers , then it appeared to them inevitable that a retirement condition must be introduced . |
15 | If IBM has any sense ( which is in itself a topic worthy of serious consideration ) it will offer versions of its engine for the entire ES/9000 range ; should it do so , the 9221 version might be nothing larger than a circuit board or two that fits in a standard rack . |
16 | Yeremi 's amazement at being tested in the presence of none other than a Space Marine was spiked with bile at the recollection of how that brat and his fellow high-life hooligans , who stood so contemptuously above any law , had hustled injured cousin Yakobi away to a vile death , crowing and bragging . |
17 | Work that wire all the way , look upon it as none other than a super-length needle with the eye in the bend of the wire . |
18 | So sensitive was the occasion , approval had to be given by none other than the Cabinet Secretary and the Permanent Secretary to the Treasury before Mr Hibbert could be exposed to the harsh winds of public controversy . |
19 | Mrs Guest was born to polite society , but broke with convention as a wayward débutante , taking to the stage and sitting for Diego Rivera in something less than a presentation gown . |
20 | Now something more than a quelling look appeared on Lord Woodleigh 's fine-bred features . |
21 | A piece to be presented should have something more than a surface narrative quality in the characterisation . |
22 | We can perhaps only guess at what exactly lay behind such incidents , although these kinds of details begin to add up to something more than a fringe resentment of the police by a marginal ‘ criminal element ’ . |
23 | as something other than a Poetry book . |
24 | Smith 's early demise opened the door for the much-anticipated return of David Gower , who had flown down for the Wimbledon men 's final in something other than a Tiger Moth the day before . |
25 | If a lake is built behind the barrage , it will be nothing more than a sewage pit . |
26 | She had allowed him to entice her into what was , to him , nothing more than a seduction scene , where she had been primed and ripe for the taking . |
27 | Dickins had had nothing more than a back pass and a free-kick to deal with in the first 30 minutes but showed signs of nervousness when Bull challenged for a Birch free-kick . |
28 | It was generally felt that the legislation was nothing more than a publicity exercise , carried out under severe pressure from the USA and the Free State government . |
29 | ‘ It is a single , rather flippant sentence in a book of 100,000 words — nothing more than a throwaway line . ’ |
30 | At the height of all the media fuss over a comic creation which was basically nothing more than a walking catch-phrase , it seemed as if Enfield 's career was in danger of burning out before it had properly ignited . |