Example sentences of "[verb] up [conj] the [num] [noun] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | She was cleaned up and the four adults sat round the table and played Scrabble . |
| 2 | One of them , a tall Hung Mao sat apart from the rest , looked up as the three men approached , then , with the vaguest movement of his head to indicate that they should go on up , looked back down at the rifle in his lap , continuing his meticulous inspection of the weapon . |
| 3 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
| 4 | Ever since then the custom has been kept up and the two halves clasped together for the marriages where it is applicable . ’ |
| 5 | He stood up and the two women stood with him . |