Example sentences of "[verb] that the [adj] [adj] [noun] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | ‘ It led us to speed it up , ’ he said , while denying that the alleged single market would of itself promote business . |
| 2 | Most palaeontologists have hitherto supposed that the nearest common ancestor of man and the modern great apes died out about 30 million years ago . |
| 3 | We had supposed that the second bacterial pattern , with separation between cytoplasmic and chromatinic content and parietal structures and often of typical ring shape intrabacterial electron opaque vacuolisation , represented the morphological consequence of a H pylori linked to nutritional conditions or to an acid or cytotoxic attack in the absence of a mucus layer , or all three . |
| 4 | Eisner and Nowicki suggest that the occasional missed meal is more than adequately compensated for by the preservation of the web . |
| 5 | Many biologists , and in particular the American Llyn Margulis , suggest that the first eukaryotic cell was formed through a symbiotic association of different prokaryotes ; by a coming-together of bacteria . |
| 6 | Because of considerable conservation of RNA polymerase domains and critical sites we suggest that the two identified genes correspond to RNA polymerase subunits of ASFV . |
| 7 | suggest that the discrete moral panics associated with the permissive age , e.g. those around abortion , VD , drugs and pornography , form the backdrop to the ‘ general crisis of the state ’ which was identified in panics around violent conduct like ‘ mugging ’ . |
| 8 | Some observers suggest that the Western nuclear industry is hoping to win major contracts to improve Eastern bloc plants , at a time when nuclear power is becoming less fashionable in the West as a whole . |
| 9 | The changing demographic composition also has implications for the physical housing stock — trends towards non-family , smaller households suggest that the traditional three-bedroom house is becoming less appropriate for present needs . |
| 10 | Our data suggest that the major groove-directed curvature of ( AGGGCCCTAGAGGGGCCCTAG ) n DNA is caused in fact by the GGGCCC , but not the CTAGAG motif . |
| 11 | Storey and Allen suggest that the faint central member of the triplet is different : it is the star cluster at the very centre of the Galaxy . |
| 12 | These observations suggest that the rectal contractile response , which is thought to be a spinal reflex and the internal sphincter relaxation , an enteric reflex , are both normally suppressed by descending inhibitory pathways . |
| 13 | In [ 26 ] they suggest that the extra contextual effects are derived by assuming that the speaker attaches a higher confirmation value to the proposition expressed than the hearer would have otherwise thought . |
| 14 | Such a finding might be seen as inconsistent with data from brain damaged patients ( Warrington and Rabin , 1970 ; De Renzi , Faglioni and Scotti , 1971 ) which suggest that the right cerebral hemisphere is more accurate than the left hemisphere in judging the orientation of a line . |
| 15 | Further to this I suggest that the optional extra subbuteo old trafford have the name written on the box as opposed to a picture as most of their ‘ so called ’ fans have never been there and so would n't recognise it . |
| 16 | Some estimates suggest that the Italian black economy has an output valued at 30 per cent of national income . |
| 17 | At the simplest level they suggest that the three dimensional structure of the matrix and availability of ligands for cell binding may be important determinants of the hepatocyte 's response to matrix constituents either alone or in combination . |
| 18 | This fit and the overall similarity of the velocities in the ionized and molecular gas suggest that the circumnuclear molecular gas is the reservoir of the gas that feeds into the nucleus at a rate of 0.03 M and ; yr -1 ( ref. 43 ) . |
| 19 | In the same paper the authors summarise geochemical studies which suggest that the younger Westphalian beds are at the wet gas stage of maturity , but that the Westphalian A , the Namurian , the Dinantian , and the Devonian are all at the dry gas stage . |
| 20 | Thus , these early heterostracans show a primitive vertebrate condition and suggest that the single branchial opening was developed independently within the heterostracan lineage and within the hagfish lineage . |
| 21 | The Slovenes , therefore , proposed that the existing foreign exchange allocation system should be abandoned , and that there should be a return to the previous system of retention ratios . |
| 22 | In May 1990 the UNDP published its first Human Development Report , which proposed that the traditional macroeconomic yardsticks , favoured by the World Bank and other international financial institutions , should be replaced by a new indicator , the " Human Development Index " ( HDI ) , which would take into account life expectancy , degree of literacy and individual purchasing power , since traditional indicators were often distorted by exchange rate fluctuations . |
| 23 | He proposed that the assumed uniform distribution of forces over any section within the specimen was a limiting state to which the forces in the real specimen approached , the further away from the extremities was the section under consideration . |
| 24 | Thus Yukawa proposed that the strong nuclear force , which holds protons and neutrons together , was carried by particles he named ‘ mesons ’ . |
| 25 | Some researchers ( for example , Bates 1976 ; Lock 1980a ) have gone a step further and proposed that the non-verbal communicative skills which are displayed in ‘ showing ’ and ‘ requesting ’ objects are direct precursors to the linguistic functions of ‘ telling ’ or ‘ giving information ’ and ‘ asking questions ’ . |
| 26 | Ernest Bevin was in the chair when Vyshinsky inquired what was happening concerning a peace settlement with Japan and proposed that the assembled foreign ministers should proceed with it . |
| 27 | The hon. Gentleman should also know that the average residential bill has been falling . |
| 28 | I did not know that the right hon. Gentleman had that black mark on his past , and I am grateful to the hon. Gentleman for pointing it out . |
| 29 | Did you know that the main natural ingredient of the quintessential English drink is to be found in the green heart of Italy ? |
| 30 | Few will doubt that the Great White Shark 's win in Canada is good for the game , but the manner in which he won his first tournament in almost 28 months did little to dispel those nagging doubts that his temperament is susceptible to pressure . |