Example sentences of "[verb] [verb] a [num] [noun] [noun] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | That is , if you do n't want to risk a 10 ft sunflower towering out of your windowbox . |
| 2 | Dr Proctor , already a wealthy man , has received an eight figure sum for the movie rights to his forthcoming autobiography What 's Cookin' , Doc ? , and director Kim Newman has already announced his intention to cast either Jeremy Irons or Steve Martin in the leading role . |
| 3 | Already one firm has developed a 30 W source of this type which gives a light like a 100 W light bulb . |
| 4 | As regards restoration , just as we would not dream of stripping out the original interior of the Blackfriar , by the same token we would not seek to preserve a Thirties estate pub which had long since ceased to address the needs of the community it was built to serve . |
| 5 | It has reported a 77 p.c. increase in complaints and cited pension transfer advice as one of the biggest problem areas . |
| 6 | Motor deal : Sanderson Townend & Gilbert has let a 980 sq ft shop at 146 High Street Redcar to Motor World . |
| 7 | As part of its future direction , ADDS previewed a 3270/X software package for migrating 3270 users to NCR 's Open Cooperative Computing Architecture beginning in the first quarter of 1993 . |
| 8 | Since you can not issue CLI " dot " commands from the keyboard , you will need to write a CLI command file using PipeDream in order to redirect the printer input or output . |
| 9 | But the British Government , unconvinced the fastest bikes are more dangerous , has won a five year exemption and an EC Commission promise to produce road safety evidence before Britain will come into line . |
| 10 | The owner of an eighteen foot fibre glass shark has won a six year battle to keep it on the roof of his terraced home . |
| 11 | Seeq Technology Inc , Fremont , California has won a six month extension of its $5m bank-credit agreement with Silicon Valley Bank ; the agreement expired on February 15 and now matures on September 30 . |
| 12 | One of Britain 's oldest breweries has won a two month battle against a hostile takeover bid . |
| 13 | For an investor who has selected a 1995 maturity date , BFS says the net asset value would have to fall by 5 per cent over the six years for the investment trust to be unable to pay up . |
| 14 | Mitsubishi has built a 10 kW model on its own , and may develop a 20 kW machine . |
| 15 | He has written a five page article about his illness in a Darlington medical journal and to celebrate his gradual return to good health he has started to learn the piano . |
| 16 | Football , and Oxford United manager Brian Horton has named a sixteen man squad for the vital relegation match against Peterboro tonight . |
| 17 | HP 's Larry Lytle , loaned to the Open Software Foundation back at its inception to handle recruiting , has made a 180 degree turn after a stint at Netwise as strategic relations director where he had philosophical differences with OSf : He 's now gone to Unix System Labs as director of corporate communications . |
| 18 | Primers were designed to amplify a 305 base pair product as INS 1 : 5' CGTGAGGGCATCGAGGTGGC 3' and INS 2 : 5' GCGTAGGCGTCGGTGACAAA 3' . |
| 19 | I feel very proud that Dounreay has had a two year advantage in setting up this system . ’ |
| 20 | A mother has offered a hundred pound reward to catch the man who shot her ten year old son in the head with an air rifle . |
| 21 | Hitachi has used a 320 watt motor in the FP 20SA , smaller than some of the competition . |
| 22 | Listed site : Southlands Management , a subsidiary of Ian Waller Developments , the Eaglescliffe-based property investment company , has bought a 5,710 sq ft grade 2 listed building at 3 to 5 Crown Street ( above ) , Darlington , for around £500,000 . |
| 23 | To try to ease the overcrowding , the National Trust has bought a 43 acre farm site nearby , to cater for visitors … |
| 24 | It is available if anybody wants to give a five pound donation to the Fox appeal . |
| 25 | Dockbuild Limited also wants to build a three storey office development on the site . |
| 26 | The Government has set a 20 p.c. limit on foreign stakes . |
| 27 | Scott Reading was the focal point of a close finish as he tried to protect a five shot lead over the closing three ends after fantastic work by Paul Maynard 's rink . |
| 28 | In another survey , HPI , the vehicle information organisation , has monitored a 5.7 p.c. rise in the number of inquiries for used vehicles from dealers , auction and finance houses . |
| 29 | Such procedures are right for generating the phenomenon in Wagner 's associative form — a series of widely spaced exposure trials will promote the formation of a context-stimulus association ; and the after-effects of presentation of the target stimulus could not be expected to survive a 24-h retention interval . |
| 30 | WaveLAN uses low power — 100mW — 2.4GHz spread spectrum technology and is claimed to have a 600 foot operating radius in open plan offices , with a 2Mbps data throughput . |